Slsep3

Slsep3

Video Analysis for Slsep3

September 24, 2007

1000 x 564

04:45

3 / 5 (2.4K ratings)

OVERVIEW

  • B

    FINAL GRADE

  • 3 / 5

    RATING

  • 2.4K

    VIEWS

ACHIEVEMENTS

  • TWO YEARS
    ONLINE

REVENUE

  • $4

    EST. TOTAL REVENUE

  • $0 - $0

    EST. MONTHLY REVENUE

  • $0 - $1

    EST. YEARLY REVENUE

GROWTH

  • 0

    AVG. DAILY VIEWS

* We try our best to gather the video's growth rate. This is an estimate for a cumulative growth of views.

VIDEO

Slsep3

extrait de Sous le soleil avec Lukas Delcourt

SOCIAL ACTIVITY

  • 8 SHARES

  • 0 TWEETS

  • 0 +1's

  • 0 PINS

  • 0 SHARES

WEB RESULTS

  • www.ingentaconnect.com   ingentaconnect Characterization of two <i xmlns="http ...

    Abstract: Two SEPALLATA orthologs, SlSEP1 and SlSEP3, were isolated from male flower buds of the dioecious plant Silene latifolia. Both genes are located on …

    http://www.ingentaconnect.com/content/klu/497/2004/00000017/00000004/art00004

  • www.nature.com   www.nature.com

    qrt-slsep3 f cggcaaacaactcaaactca qrt-slsep3 r tgataggaaaaccattgagca qrt-slfulch2f agaaagcgctccaagaacaa qrt-slfulch2r atggcggtatcaatgaggaa qrt ubi mf qrt ubi mr

    http://www.nature.com/ng/journal/v44/n12/extref/ng.2465-S4.xlsx

  • kathiskrystals.com   Kathi's Krystals - Septarian Fluorescent Minerals

    High quality Septarian Fluorescent Minerals from Kathi's Krystals

    http://kathiskrystals.com/index.php?main_page=index&cPath=116_229

  • www.genetics.org   PowerPoint Presentation

    Silene_l_SlSEP3 FFHPLE-C--EP--TLQIG-Y-----QP-E-Q--MN-----VT-A----AG-PS--I-N-N-F-MT--GWL-PQN----- Sinapis_a ...

    http://www.genetics.org/content/suppl/2014/11/14/genetics.104.037770.DC1/Sup-Figures-Zahn.ppt

  • kathiskrystals.com   Kathi's Krystals - Septarian Slabs

    From Utah!Measurements: 6.1 x 5.1 x 0.5 inches.Slab comes with a velour... $27.95: slsep3: Septarian Slab. From Utah!Measurements: 5.9 x 5.1 x 0.5 inches.Slab comes ...

    http://kathiskrystals.com/index.php?main_page=index&cPath=129_666

  • www.researchgate.net   Characterization of two SEPALLATA MADS-box genes …

    Two SEPALLATA orthologs, SlSEP1 and SlSEP3, were isolated from male flower buds of the dioecious plant Silene latifolia. Both genes are located on autosomes and not ...

    http://www.researchgate.net/publication/225180365_Characterization_of_two_SEPALLATA_MADS-box_genes_from_the_dioecious_plant_Silene_latifolia

  • www.researchgate.net   Isolation and characterization of two homeodomain leucine …

    Isolation and characterization of two homeodomain leucine zipper genes from the dioecious plant Silene latifolia on ResearchGate, the professional network for scientists.

    http://www.researchgate.net/publication/8959543_Isolation_and_characterization_of_two_homeodomain_leucine_zipper_genes_from_the_dioecious_plant_Silene_latifolia

  • www.cell.com   SEPALLATA gene diversification: brave new whorls

    PhFBP4, PhFBP5, PhFBP9, PhFBP23 [29], PhpMADS12 [20]; Pisum PsMADS, [57]; Setaria SiLHS1 [38]; Silene SlSEP1, SlSEP3 [58]; Sinapis SaMADSD [13]; Sorghum …

    http://www.cell.com/trends/plant-science/pdf/S1360-1385(05)00176-7.pdf

  • www.cell.com   SEPALLATA gene diversification: brave new whorls: Trends ...

    ... PhFBP2, PhFBP4, PhFBP5, PhFBP9, PhFBP23 [29] , PhpMADS12 [20] ; Pisum PsMADS, [57] ; Setaria SiLHS1 [38] ; Silene SlSEP1, SlSEP3 [58] ; Sinapis …

    http://www.cell.com/trends/plant-science/abstract/S1360-1385(05)00176-7

  • www.sciencedirect.com   SEPALLATA gene diversification: brave new whorls

    SEPALLATA gene diversification: brave new whorls. Simon T. Malcomber, Elizabeth A. Kellogg; Department of Biology, ... Silene SlSEP1, SlSEP3; Sinapis SaMADSD ...

    http://www.sciencedirect.com/science/article/pii/S1360138505001767

  • www.ibp.cz   Biofyzikální ústav AV ČR - IBP

    Two SEPALLATA orthologs, SlSEP1 and SlSEP3, were isolated from male flower buds of the dioecious plant Silene latifolia. Both genes are located on autosomes and not ...

    http://www.ibp.cz/cs/oddeleni/vyvojova-genetika-rostlin/publication-3523/

  • www.pnas.org   www.pnas.org

    Laurales. Persea americana. Pe.am.AP1 . DQ398019 . AP1. Pe.am.AP3. AY337748. AP3. Pe.am.AG.1 . DQ398021 . AG. Pe.am.AG.2 . DQ398022. AG. Pe.am.AG.3 . …

    http://www.pnas.org/content/suppl/2013/10/25/1310356110.DCSupplemental/st01.docx

  • www.dailymotion.com   Mammamia! Trailer - Video Dailymotion

    Dec 21, 2007 · Video embedded · Watch the video «Mammamia! Trailer» uploaded by Alain Bassil on Dailymotion.

    http://www.dailymotion.com/video/x3thtm_mammamia-trailer_shortfilms

  • www.dailymotion.com   SMqX - Video Dailymotion

    Dec 08, 2007 · Watch the video «SMqX» uploaded by bugmafia on Dailymotion.

    http://www.dailymotion.com/video/x3peyq_smqx_music

  • www.ijetch.org   Cloning and Characterization of MADS-box Gene in …

    and SlSEP3 (AB162020) and apple MdMADS4 (U78950). % of Identity Plant Species Gene MADS domain K domain Asparagus officinalis AOM1 100 96 Liriodendron ...

    http://www.ijetch.org/papers/062.pdf

  • www.biomedcentral.com   www.biomedcentral.com

    ... (dq159905), osmads1 (l34271), osmads5 (u78890), zmm6 (aj430692), zmm27 (aj430694), vvmads4 (af373603), slsep3 (bad10945), ljsep3 (ay770397) ...

    http://www.biomedcentral.com/content/epub/1471-2229-14-89.epub

  • www.biomedcentral.com   BMC Plant Biology | Full text | A soybean MADS-box …

    ... osmads1 (l34271), osmads5 (u78890), zmm6 (aj430692), zmm27 (aj430694), vvmads4 (af373603), slsep3 (bad10945), ljsep3 (ay770397) ...

    http://www.biomedcentral.com/1471-2229/14/89

  • www.science.gov   www.science.gov

    Characterization of the Possible Roles for B Class MADS Box Genes in Regulation of Perianth Formation in Orchid1[C. PubMed Central. Chang, Yu-Yun; Kao, Nai-Hsuan; Li ...

    http://www.science.gov/topicpages/b/b-class+mads-box+genes.html

  • www.science.gov   www.science.gov

    Acylated iridoids from the roots of Valeriana officinalis var. latifolia. PubMed. Han, Zhu-zhen; Yan, Zhao-hui; Liu, Qing-xin; Hu, Xian-qing; Ye, Ji; Li, Hui-liang ...

    http://www.science.gov/topicpages/v/var+latifolia+buckley.html

  • hgdownload.cse.ucsc.edu   hgdownload.cse.ucsc.edu

    0 n/a 1 thrB 2 argA 3 sam-pr 4 pufL 5 hacA 6 nifH 7 azr 8 enolA 9 LipL32 10 comS 11 SsgB 12 SshEstI 13 rpoB 14 gyrB 15 moxA 16 boxA 17 slpA 18 dnaK 19 lipL41 20 ...

    http://hgdownload.cse.ucsc.edu/gbdb/genbank/grepIndex/caeJap1/geneName.idName

  • Show More