

Video Analysis for Slsep3

September 24, 2007

1000 x 564


3 / 5 (2.4K ratings)


  • B


  • 3 / 5


  • 2.4K





  • $4


  • $0 - $0


  • $0 - $1



  • 0


* We try our best to gather the video's growth rate. This is an estimate for a cumulative growth of views.



extrait de Sous le soleil avec Lukas Delcourt



  • 0 TWEETS

  • 0 +1's

  • 0 PINS



  •   Characterization of two SEPALLATA MADS-box genes …

    Abstract. Two SEPALLATA orthologs, SlSEP1 and SlSEP3, were isolated from male flower buds of the dioecious plant Silene latifolia. Both genes are located on …

  •   ingentaconnect Characterization of two <i xmlns="http ...

    Abstract: Two SEPALLATA orthologs, SlSEP1 and SlSEP3, were isolated from male flower buds of the dioecious plant Silene latifolia. Both genes are located on …


    qrt-slsep3 f cggcaaacaactcaaactca qrt-slsep3 r tgataggaaaaccattgagca qrt-slfulch2f agaaagcgctccaagaacaa qrt-slfulch2r atggcggtatcaatgaggaa qrt ubi mf qrt ubi mr

  •   Kathi's Krystals - Septarian Fluorescent Minerals

    High quality Septarian Fluorescent Minerals from Kathi's Krystals

  •   PowerPoint Presentation

    Silene_l_SlSEP3 FFHPLE-C--EP--TLQIG-Y-----QP-E-Q--MN-----VT-A----AG-PS--I-N-N-F-MT--GWL-PQN----- Sinapis_a ...

  •   Kathi's Krystals - Septarian Slabs

    From Utah!Measurements: 6.1 x 5.1 x 0.5 inches.Slab comes with a velour... $27.95: slsep3: Septarian Slab. From Utah!Measurements: 5.9 x 5.1 x 0.5 inches.Slab comes ...

  •   Characterization of two SEPALLATA MADS-box genes …

    Two SEPALLATA orthologs, SlSEP1 and SlSEP3, were isolated from male flower buds of the dioecious plant Silene latifolia. Both genes are located on autosomes and not ...

  •   Isolation and characterization of two homeodomain leucine …

    Isolation and characterization of two homeodomain leucine zipper genes from the dioecious plant Silene latifolia on ResearchGate, the professional network for scientists.

  •   SEPALLATA gene diversification: brave new whorls

    PhFBP4, PhFBP5, PhFBP9, PhFBP23 [29], PhpMADS12 [20]; Pisum PsMADS, [57]; Setaria SiLHS1 [38]; Silene SlSEP1, SlSEP3 [58]; Sinapis SaMADSD [13]; Sorghum …

  •   SEPALLATA gene diversification: brave new whorls: Trends ...

    ... PhFBP2, PhFBP4, PhFBP5, PhFBP9, PhFBP23 [29] , PhpMADS12 [20] ; Pisum PsMADS, [57] ; Setaria SiLHS1 [38] ; Silene SlSEP1, SlSEP3 [58] ; Sinapis …

  •   SEPALLATA gene diversification: brave new whorls

    SEPALLATA gene diversification: brave new whorls. Simon T. Malcomber, Elizabeth A. Kellogg; Department of Biology, ... Silene SlSEP1, SlSEP3; Sinapis SaMADSD ...

  •   Biofyzikální ústav AV ČR - IBP

    Two SEPALLATA orthologs, SlSEP1 and SlSEP3, were isolated from male flower buds of the dioecious plant Silene latifolia. Both genes are located on autosomes and not ...


    Laurales. Persea americana. . DQ398019 . AP1. AY337748. AP3. . DQ398021 . AG. . DQ398022. AG. . …

  •   Mammamia! Trailer - Video Dailymotion

    Dec 21, 2007 · Video embedded · Watch the video «Mammamia! Trailer» uploaded by Alain Bassil on Dailymotion.

  •   SMqX - Video Dailymotion

    Dec 08, 2007 · Watch the video «SMqX» uploaded by bugmafia on Dailymotion.

  •   Cloning and Characterization of MADS-box Gene in …

    and SlSEP3 (AB162020) and apple MdMADS4 (U78950). % of Identity Plant Species Gene MADS domain K domain Asparagus officinalis AOM1 100 96 Liriodendron ...


    ... (dq159905), osmads1 (l34271), osmads5 (u78890), zmm6 (aj430692), zmm27 (aj430694), vvmads4 (af373603), slsep3 (bad10945), ljsep3 (ay770397) ...

  •   BMC Plant Biology | Full text | A soybean MADS-box …

    ... osmads1 (l34271), osmads5 (u78890), zmm6 (aj430692), zmm27 (aj430694), vvmads4 (af373603), slsep3 (bad10945), ljsep3 (ay770397) ...


    Characterization of the Possible Roles for B Class MADS Box Genes in Regulation of Perianth Formation in Orchid1[C. PubMed Central. Chang, Yu-Yun; Kao, Nai-Hsuan; Li ...


    Acylated iridoids from the roots of Valeriana officinalis var. latifolia. PubMed. Han, Zhu-zhen; Yan, Zhao-hui; Liu, Qing-xin; Hu, Xian-qing; Ye, Ji; Li, Hui-liang ...

  • Show More